KMC000036A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KMC000036A_C01 KMC000036A_c01
ttttagtcttttatcattaataagatatactcaaagaaaacagaaaagaaAAAGAACTCA
CCATTTCATTAATTTATTATCATAATCATAGCCATATGGCTCAGGATAATAGTAAAGTAT
TTTTTTTAAGCAAAAGATGAAGGTTTAATGTAGGATAATAATAATGGGAAACATGCCCTC
CCAAGTGAGCAAAACAGCATTTAATCAAATGCACCCTTATGACACAGCAAATGGCCAAAT
TCTGTATCACCAACAAAGCATGGCCAAACACTGAATCAAACCCACATAGCCCCAACCAGA
TTAATTGCCTAGACCCACATCAAAATTAGAAGCACATAGCCACATCCACGCATTCATGAA
ACTGCATTGTGGCTTAGCACATTACATTATAGCCTTATATATATCCCACACATCATGACA
GTAAAATCATATCAGTGTTATATACCAGTAAAAAATAGCCGCACTACAGCTTGTGTCCCC
CATGCCTTTAAAACTCTCATACACAACTGCATTGGAAGGTAGAGAGAAAAGTGAACCTGA
TAAGTTGAGAGCAGTGGCTAGTGGATGTCTATCCAATCGCATCTTCACTTAGCCATA


Nr search

BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KMC000036A_C01 KMC000036A_c01
         (597 letters)

Database: nr 
           1,393,205 sequences; 448,689,247 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gb|AAK95061.1| olfactory receptor [Homo sapiens]                       32  4.7
ref|XP_210169.1| similar to olfactory receptor MOR232-9 [Mus mus...    32  4.7

>gb|AAK95061.1| olfactory receptor [Homo sapiens]
          Length = 213

 Score = 32.3 bits (72), Expect = 4.7
 Identities = 20/67 (29%), Positives = 32/67 (46%)
 Frame = -2

Query: 422 TVMMCGIYIRL*CNVLSHNAVS*MRGCGYVLLILMWV*AINLVGAMWV*FSVWPCFVGDT 243
           TVM C  Y+ + C  L++  +     C  +L+ + WV    L   + + F+VW  F G  
Sbjct: 49  TVMACDCYVAI-CKPLNYTTIMSHSLC-ILLVAVAWVGGF-LHATIQILFTVWLPFCGPN 105

Query: 242 EFGHLLC 222
             GH +C
Sbjct: 106 VIGHFMC 112

>ref|XP_210169.1| similar to olfactory receptor MOR232-9 [Mus musculus] [Homo
           sapiens]
          Length = 346

 Score = 32.3 bits (72), Expect = 4.7
 Identities = 20/67 (29%), Positives = 32/67 (46%)
 Frame = -2

Query: 422 TVMMCGIYIRL*CNVLSHNAVS*MRGCGYVLLILMWV*AINLVGAMWV*FSVWPCFVGDT 243
           TVM C  Y+ + C  L++  +     C  +L+ + WV    L   + + F+VW  F G  
Sbjct: 114 TVMACDCYVAI-CKPLNYTTIMSHSLC-ILLVAVAWVGGF-LHATIQILFTVWLPFCGPN 170

Query: 242 EFGHLLC 222
             GH +C
Sbjct: 171 VIGHFMC 177

  Database: nr
    Posted date:  Apr 1, 2003  2:05 AM
  Number of letters in database: 448,689,247
  Number of sequences in database:  1,393,205
  
Lambda     K      H
   0.318    0.135    0.401 

Gapped
Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Hits to DB: 513,085,363
Number of Sequences: 1393205
Number of extensions: 11261308
Number of successful extensions: 20924
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 20333
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 20895
length of database: 448,689,247
effective HSP length: 117
effective length of database: 285,684,262
effective search space used: 23140425222
frameshift window, decay const: 50,  0.1
T: 12
A: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)


EST assemble image


clone accession position
1 GENLf002b08 BP062456 1 579
2 GENf080e12 BP061788 51 523
3 GENf009h07 BP058745 51 404
4 GENf098f09 BP062345 108 466
5 GENLf070f01 BP066131 128 599




Lotus japonicus
Kazusa DNA Research Institute
Department of Plant Gene Research