KCC000450A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000450A_C01 KCC000450A_c01
acgTTCACATTGACACCCTCAAGATTTGCGTGCTGAACAAGCTAAAATGACGTCCAAGCG
ACCCCTGCATTCAATCCTGCTCTCGTGCGTGTGCGTAGTCGCGATGGGCTCCTCGCAGCG
TGCAAAATTAGCTAATCGGGATGCCACAATGGGCAAGAGACTCTGAAGAGTTGCGCGTCA
ACCGACGCGTCGTTACTTGGGTGAACAACCCCAGTCCTTCGGCAGCACCACACTGAACAG
CTGGACGTGGGTACGTGCTGTACTCGAAGCGGCGTCGACAGCTGCCGCGTCCCTGGACCG
GAACGAGCCCGTTGCGCTGACGTGTGGCGCGCGCCAGACCTCTCGGCATGGCCAACGTTT
CGGAGCACCGTTCGCCAGCACGGCTTAATGCCGAGACGGGAGCTCGAGACATGCGAGACG
AACCTTTAGATGTGCTAGTCATTGGCGCGGGCATCAGCGGCCTCGCAGCGGCCTCCGCCC
TGCAGCGGCATGGCTTGCGTGTTGCAGTGCTGGAGTCTCGGGCGCGCGTGGGCGGGCGAA
TCA


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000450A_C01 KCC000450A_c01
         (543 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

ref|XP_320852.1| ENSANGP00000004834 [Anopheles gambiae] gi|21287...    52  7e-06
ref|NP_851532.1| putative dehydrogenase [Streptomyces rochei] gi...    51  1e-05
ref|NP_295447.1| hypothetical protein [Deinococcus radiodurans] ...    50  1e-05
dbj|BAB40417.1| putative monoamine oxidase A [Cavia porcellus]         50  1e-05
pir||T44374 hypothetical protein 509e [imported] - Deinococcus r...    50  1e-05

>ref|XP_320852.1| ENSANGP00000004834 [Anopheles gambiae] gi|21287760|gb|EAA00081.1|
           ENSANGP00000004834 [Anopheles gambiae str. PEST]
          Length = 650

 Score = 51.6 bits (122), Expect = 7e-06
 Identities = 27/37 (72%), Positives = 30/37 (80%)
 Frame = +3

Query: 432 VLVIGAGISGLAAASALQRHGLRVAVLESRARVGGRI 542
           V+VIGAGISGLAAA  LQ+ G  V VLE+R RVGGRI
Sbjct: 108 VIVIGAGISGLAAAQQLQQFGFDVIVLEARDRVGGRI 144

>ref|NP_851532.1| putative dehydrogenase [Streptomyces rochei]
           gi|30698455|dbj|BAC76568.1| putative dehydrogenase
           [Streptomyces rochei]
          Length = 515

 Score = 50.8 bits (120), Expect = 1e-05
 Identities = 30/71 (42%), Positives = 37/71 (51%)
 Frame = +3

Query: 330 RARPLGMANVSEHRSPARLNAETGARDMRDEPLDVLVIGAGISGLAAASALQRHGLRVAV 509
           RA   G A     R    L A  GA  +   P  V VIG GI+GLAAA+AL   G+ V +
Sbjct: 2   RAARQGAARRGRDRRARMLPAPPGAARVAGNPPSVAVIGGGIAGLAAATALAERGVAVTL 61

Query: 510 LESRARVGGRI 542
            E R  +GGR+
Sbjct: 62  YEKRPYLGGRV 72

>ref|NP_295447.1| hypothetical protein [Deinococcus radiodurans]
           gi|7472072|pir||A75361 hypothetical protein -
           Deinococcus radiodurans (strain R1)
           gi|6459501|gb|AAF11286.1|AE002014_7 hypothetical protein
           [Deinococcus radiodurans]
          Length = 441

 Score = 50.4 bits (119), Expect = 1e-05
 Identities = 24/49 (48%), Positives = 32/49 (64%)
 Frame = +3

Query: 396 TGARDMRDEPLDVLVIGAGISGLAAASALQRHGLRVAVLESRARVGGRI 542
           TG+R       D++V+GAG++GL AA  LQR G  V VLES   +GGR+
Sbjct: 4   TGSRGAESTGADIIVVGAGLAGLTAARTLQRAGKTVRVLESSQHLGGRV 52

>dbj|BAB40417.1| putative monoamine oxidase A [Cavia porcellus]
          Length = 506

 Score = 50.4 bits (119), Expect = 1e-05
 Identities = 26/37 (70%), Positives = 28/37 (75%)
 Frame = +3

Query: 429 DVLVIGAGISGLAAASALQRHGLRVAVLESRARVGGR 539
           DV+VIG GISGLAAA  L  H L V VLE+R RVGGR
Sbjct: 15  DVVVIGGGISGLAAAKLLSEHELSVLVLEARDRVGGR 51

>pir||T44374 hypothetical protein 509e [imported] - Deinococcus radiodurans
           (fragment) gi|3426015|dbj|BAA32392.1| unnamed protein
           product [Deinococcus radiodurans]
          Length = 324

 Score = 50.4 bits (119), Expect = 1e-05
 Identities = 24/49 (48%), Positives = 32/49 (64%)
 Frame = +3

Query: 396 TGARDMRDEPLDVLVIGAGISGLAAASALQRHGLRVAVLESRARVGGRI 542
           TG+R       D++V+GAG++GL AA  LQR G  V VLES   +GGR+
Sbjct: 4   TGSRGAESTGADIIVVGAGLAGLTAARTLQRAGKTVRVLESSQHLGGRV 52



EST assemble image


clone accession position
1 LCL047g09_r AV628836 1 177
2 CL38g09_r AV395322 4 527
3 CL57a07_r AV396289 14 535
4 HCL057f06_r AV642772 16 529
5 LCL028f10_r AV627568 19 492
6 CL42d11_r AV395480 19 539
7 CL30d07_r AV394757 28 543
8 LCL083b04_r AV630714 28 413
9 HCL011b11_r AV640145 42 209
10 CL33e10_r AV394955 55 530




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research