KCC000423A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000423A_C01 KCC000423A_c01
catgaatcaatctGCAAAACTCATCTCAGAATTGTCCCAGGCCGGTTGAAGGACCCGCAA
GCTAGTGTCGCAAGCTGACCTGCGCGTTGTTGACCATGCATTCTTAGTCAATTGTCTTAA
CTGATATCTATAGTCACAGTTTAGGCCATGGACGGGGAGTCGGCACCAGCTTTCCGCTTC
AACTTCGGCAAAGAGGAGGCGGAGCAGGTCCAGGAGGAGCAGGGACCACCGGAGTATGAC
GAGCCGGCCGAGGAACTCGTATATCGGCCAGAACCCGGCGTGCCCTTCTTCACAGAGCCA
GTGGAAGTAGCAGAGGGCCTTACTCTCGTAAAGGGCACCATCTCCTCGGATGAGGCGGCC
ACCATCCTCAAGGATTCACGTGTGGCGGCCAGCGACCTGGTGCCGGGGAAGTACGAGGGC
GGCTTCAAGCTGTGGGAGTGTGCGGCCGACCTGTGCAAGGCGGTGCTGGCGCGGTACGGC
CTGACGGCGGCGGAGCTGGCGGGGGCGGCGGAGCTGCACTCGCAGTTGCAGG


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000423A_C01 KCC000423A_c01
         (532 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gb|AAB70928.1| proline rich protein [Santalum album]                   60  2e-08
ref|NP_776644.1| Wiskott-Aldrich syndrome-like [Bos taurus] gi|1...    59  5e-08
gb|AAL31655.1|AC079179_10 Unknown protein [Oryza sativa] gi|2004...    57  2e-07
gb|AAH55045.1| Wasl protein [Mus musculus]                             56  3e-07
emb|CAC69994.1| N-WASP protein [Mus musculus]                          56  3e-07

>gb|AAB70928.1| proline rich protein [Santalum album]
          Length = 326

 Score = 59.7 bits (143), Expect = 2e-08
 Identities = 46/130 (35%), Positives = 57/130 (43%), Gaps = 2/130 (1%)
 Frame = -1

Query: 526 TASAAPPPPPAPPPSGRTAPAPPCTGRPHTPTA*SRPR--TSPAPGRWPPHVNP*GWWPP 353
           T S +PP P + PP+   +P+PP T +P  P+  S P   TSP P   PP  +P    PP
Sbjct: 214 TTSPSPPTPRSVPPTPPASPSPP-TAKPSPPSRGSSPSPPTSPTPTPRPPSYSP-SPTPP 271

Query: 352 HPRRWCPLRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPAPPGPAPPPLCRS*SG 173
             R   PLR   P+L P                P PA   P+  +PP P  PP C S   
Sbjct: 272 SSRPSPPLR--SPILTP----------------PSPAAVPPIGRSPPSPIDPP-CSSPEP 312

Query: 172 KLVPTPRPWP 143
              PT  P P
Sbjct: 313 SSPPTSPPTP 322

 Score = 42.4 bits (98), Expect = 0.004
 Identities = 45/149 (30%), Positives = 52/149 (34%), Gaps = 19/149 (12%)
 Frame = -1

Query: 532 PATASAAPPPPPAPPPSGRTAPAPPC---TGRPHTPTA*SRPRT-----------SPAPG 395
           P T   +P PP +  PS   +P PP    T RP +PT  S P T           SP+P 
Sbjct: 128 PPTVRRSPSPPESASPS--PSPGPPAATPTPRPSSPT--STPPTDGETPRPPGPRSPSPS 183

Query: 394 RWPPHVNP*GWWPPHPRRWCPLRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPAP 215
             PP  +P    P  P    P    GP                    P P    P  PA 
Sbjct: 184 PGPPSCSPSPKSPSPPASSPPRSRPGP-----------PDYTTSPSPPTPRSVPPTPPAS 232

Query: 214 PG-----PAPPPLCRS*SGKLVPTPRPWP 143
           P      P+PP    S S    PTP P P
Sbjct: 233 PSPPTAKPSPPSRGSSPSPPTSPTPTPRP 261

 Score = 37.0 bits (84), Expect = 0.16
 Identities = 37/130 (28%), Positives = 52/130 (39%), Gaps = 13/130 (10%)
 Frame = -1

Query: 532 PATASAAPP-----PPPAPPPSGRTAPAPP-CTGRPHTPT--A*SRPRTSPAPGRWPPHV 377
           P++ ++ PP     P P  P S   +P PP C+  P +P+  A S PR+ P P  +    
Sbjct: 158 PSSPTSTPPTDGETPRPPGPRSPSPSPGPPSCSPSPKSPSPPASSPPRSRPGPPDYTTSP 217

Query: 376 NP*GWWPPHPRRWCPLRE*GP-----LLLPLAL*RRARRVLADIRVPRPARHTPVVPAPP 212
           +     PP PR   P     P        P +         +    PRP  ++P  P PP
Sbjct: 218 S-----PPTPRSVPPTPPASPSPPTAKPSPPSRGSSPSPPTSPTPTPRPPSYSP-SPTPP 271

Query: 211 GPAPPPLCRS 182
              P P  RS
Sbjct: 272 SSRPSPPLRS 281

>ref|NP_776644.1| Wiskott-Aldrich syndrome-like [Bos taurus]
           gi|13431968|sp|Q95107|WASL_BOVIN Neural Wiskott-Aldrich
           syndrome protein (N-WASP) gi|7513472|pir||S72273
           actin-depolymerizing protein N-WASP, brain - bovine
           gi|1644232|dbj|BAA11082.1| N-WASP [Bos taurus]
          Length = 505

 Score = 58.5 bits (140), Expect = 5e-08
 Identities = 49/134 (36%), Positives = 51/134 (37%), Gaps = 8/134 (5%)
 Frame = -1

Query: 532 PATASAAPPPPPAPPPSGRTAPAPPCTGRPHTPTA*SRPRTSPAPGRWPPHVNP*GWWPP 353
           P   S   PPPP PPP     P PP  GR   P   SR  T+ AP   PP     G  PP
Sbjct: 279 PPPPSRGGPPPPPPPPHSSGPPPPPARGRGAPPPPPSRAPTA-APPPPPPSRPGVGAPPP 337

Query: 352 HPRRWCP--------LRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPAPPGPAPP 197
            P R  P            GP   P  L      V   +  P P    P  P PPGP PP
Sbjct: 338 PPNRMYPPPLPALPSSAPSGPPPPPPPL-----SVSGSVAPPPP----PPPPPPPGPPPP 388

Query: 196 PLCRS*SGKLVPTP 155
           P   S     VPTP
Sbjct: 389 PGLPSDGDHQVPTP 402

>gb|AAL31655.1|AC079179_10 Unknown protein [Oryza sativa] gi|20042881|gb|AAM08709.1|AC116601_2
           Unknown protein [Oryza sativa]
           gi|31429914|gb|AAP51898.1| unknown protein [Oryza sativa
           (japonica cultivar-group)]
          Length = 1269

 Score = 56.6 bits (135), Expect = 2e-07
 Identities = 46/134 (34%), Positives = 54/134 (39%), Gaps = 8/134 (5%)
 Frame = -1

Query: 532 PATASAAPPPPPAPPPSGR--------TAPAPPCTGRPHTPTA*SRPRTSPAPGRWPPHV 377
           P  A+  PPPPP PPPSG           P PP    P +  A S+P   P P   P  +
Sbjct: 539 PTAAAPPPPPPPPPPPSGNKPAFSPPPPPPPPPPPPLPQSNYASSQPPPPPPPPPLPNCL 598

Query: 376 NP*GWWPPHPRRWCPLRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPAPPGPAPP 197
            P    PP P          P +LP       R V      P P  +  V+P PP P PP
Sbjct: 599 VPSPPPPPPP----------PPILP------NRSVPPPPPPPPPLPNHSVLPPPPPPPPP 642

Query: 196 PLCRS*SGKLVPTP 155
           P   S   +LVP P
Sbjct: 643 P---SLPNRLVPPP 653

 Score = 47.4 bits (111), Expect = 1e-04
 Identities = 41/129 (31%), Positives = 48/129 (36%), Gaps = 17/129 (13%)
 Frame = -1

Query: 529 ATASAAPPPPPAP--PPSGRT-----------APAPPCTGRPHTPTA*SRPRTSPAPG-- 395
           AT+S  PPPPP P  PP+ RT            P PP   R + P+A + P   P P   
Sbjct: 683 ATSSKGPPPPPPPPLPPANRTNGPGVPSAPPPPPPPPPANRSNGPSAPAPPLPPPLPAAA 742

Query: 394 --RWPPHVNP*GWWPPHPRRWCPLRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVP 221
             R PP        PP P              PL   ++A         P P    P  P
Sbjct: 743 NKRNPPA-------PPPP--------------PLMTGKKA---------PAPPPPPPQAP 772

Query: 220 APPGPAPPP 194
            PPG  PPP
Sbjct: 773 KPPGTVPPP 781

 Score = 43.9 bits (102), Expect = 0.001
 Identities = 47/141 (33%), Positives = 52/141 (36%), Gaps = 18/141 (12%)
 Frame = -1

Query: 511  PPPPPAPPPS--GRTAPAPPCTG----------RPHTPTA*SRPRTSPAPGRWPPHVNP* 368
            PPPPP PPPS   R  P PP  G           P  P + SR  T  A     P   P 
Sbjct: 635  PPPPPPPPPSLPNRLVPPPPAPGIGNKFPAPPPPPPPPRSSSRTPTGAATSSKGPPPPPP 694

Query: 367  GWWPPHPRRWCP-LRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPA-----PPGP 206
               PP  R   P +    P   P     R+    A    P P    P+  A     PP P
Sbjct: 695  PPLPPANRTNGPGVPSAPPPPPPPPPANRSNGPSA----PAPPLPPPLPAAANKRNPPAP 750

Query: 205  APPPLCRS*SGKLVPTPRPWP 143
             PPPL    +GK  P P P P
Sbjct: 751  PPPPLM---TGKKAPAPPPPP 768

 Score = 38.1 bits (87), Expect = 0.071
 Identities = 37/136 (27%), Positives = 42/136 (30%), Gaps = 11/136 (8%)
 Frame = -1

Query: 511 PPPPPAPPPSGRTAPAPPCTGRPHTPTA*SRPRTSPAPGRWPPHVNP*GWWPPHPRRWCP 332
           PPPPP  P      P PP    P  P     P  +P  G   P   P    PP P     
Sbjct: 621 PPPPPPLPNHSVLPPPPPPPPPPSLPNRLVPPPPAPGIGNKFPAPPP----PPPP----- 671

Query: 331 LRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVP-----------APPGPAPPPLCR 185
                    P +  R         + P P    P+ P           APP P PPP   
Sbjct: 672 ---------PRSSSRTPTGAATSSKGPPPPPPPPLPPANRTNGPGVPSAPPPPPPPPPAN 722

Query: 184 S*SGKLVPTPRPWPKL 137
             +G   P P   P L
Sbjct: 723 RSNGPSAPAPPLPPPL 738

>gb|AAH55045.1| Wasl protein [Mus musculus]
          Length = 501

 Score = 56.2 bits (134), Expect = 3e-07
 Identities = 46/129 (35%), Positives = 49/129 (37%), Gaps = 3/129 (2%)
 Frame = -1

Query: 532 PATASAAPPPPPAPPPSGRTAPAPPCTGRPHTPTA*SR-PRTSPAPGRWPPHVNP*GWWP 356
           P   S   PPPP PPP     P PP  GR   P   SR P  +P P   PP   P    P
Sbjct: 276 PPPPSRGGPPPPPPPPHSSGPPPPPARGRGAPPPPPSRAPTAAPPP---PPPSRPGVVVP 332

Query: 355 PHP--RRWCPLRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPAPPGPAPPPLCRS 182
           P P  R + P     P   P          +A    P P    P  P PPGP PPP   S
Sbjct: 333 PPPPNRMYPPPPPALPSSAPSGPPPPPPPSMAGSTAPPP---PPPPPPPPGPPPPPGLPS 389

Query: 181 *SGKLVPTP 155
                VP P
Sbjct: 390 DGDHQVPAP 398

>emb|CAC69994.1| N-WASP protein [Mus musculus]
          Length = 501

 Score = 56.2 bits (134), Expect = 3e-07
 Identities = 46/129 (35%), Positives = 49/129 (37%), Gaps = 3/129 (2%)
 Frame = -1

Query: 532 PATASAAPPPPPAPPPSGRTAPAPPCTGRPHTPTA*SR-PRTSPAPGRWPPHVNP*GWWP 356
           P   S   PPPP PPP     P PP  GR   P   SR P  +P P   PP   P    P
Sbjct: 276 PPPPSRGGPPPPPPPPHSSGPPPPPARGRGAPPPPPSRAPTAAPPP---PPPSRPGVVVP 332

Query: 355 PHP--RRWCPLRE*GPLLLPLAL*RRARRVLADIRVPRPARHTPVVPAPPGPAPPPLCRS 182
           P P  R + P     P   P          +A    P P    P  P PPGP PPP   S
Sbjct: 333 PPPPNRMYPPPPPALPSSAPSGPPPPPPPSMAGSTAPPP---PPPPPPPPGPPPPPGLPS 389

Query: 181 *SGKLVPTP 155
                VP P
Sbjct: 390 DGDHQVPAP 398



EST assemble image


clone accession position
1 HCL054e12_r AV642604 1 460
2 HCL040h08_r AV641824 14 517
3 CM087f07_r AV392476 15 534
4 CL27h08_r AV394723 15 531




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research