KCC000416A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000416A_C01 KCC000416A_c01
cccccctttttttttttttcttttttttttttttttCTCTTCCGTCAGTTACACAAAAAA
GTATGGGCGCGACACCTCATGGGCAGCTCCAGCCTGGTAAACTCCGCGTGGCCCACGCCA
CGGTACTTGCCCGGCGGCACGGCCGGGAAACGCCAGCGCGTGCAACCGAGGGCCAGCGCT
CGCAGAAGCCGGGCATGACAAAGCGCACACCAACGATGGTGTCATTGAATGCCTTACTGC
AGATGTTGTGCAGCCGGTCGCCAGCCTTGGAGTGCAGCACCCAGCGCTAATGGTTTTCCC
TCCCAAGGGGAAAGTGGGCAGCGCCCAAGCCACGTAGGTGCGTCTCTAAGGCCGCAAGCA
TCTACCTCATCTCCCGGCCATAGCCGGGGTCTGTTGGTATAGGCACCGCCCGCCATGTGT
CCAGCCACGTCTCGCTGTCAAGCACAAGCACAGCAATAAATCATACCACACACTGTGCCA
TGCAAAACTCGCCAGCGAAGACTGCGAAACAGGCACCAGCCGGG


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000416A_C01 KCC000416A_c01
         (524 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

ref|NP_005520.2| heparan sulfate proteoglycan 2; heparan sulfate...    38  0.090
pir||A38096 perlecan precursor - human gi|184427|gb|AAA52700.1| ...    38  0.090
sp|P98160|PGBM_HUMAN Basement membrane-specific heparan sulfate ...    38  0.090
gb|AAA52699.1| heparan sulfate proteoglycan                            38  0.090
emb|CAC18534.1| heparan sulfate proteoglycan perlecan [Homo sapi...    38  0.090

>ref|NP_005520.2| heparan sulfate proteoglycan 2; heparan sulfate proteoglycan of
            basement membrane; endorepellin (domain V region);
            perlecan [Homo sapiens] gi|29470|emb|CAA44373.1| Human
            basement membrane heparan sulfate proteoglycan core
            protein [Homo sapiens]
          Length = 4393

 Score = 37.7 bits (86), Expect = 0.090
 Identities = 27/81 (33%), Positives = 34/81 (41%), Gaps = 7/81 (8%)
 Frame = +1

Query: 232  PYCRCCA---AGRQPWSAAPSANGFPSQGESGQR----PSHVGASLRPQASTSSPGHSRG 390
            P C  C+   +GR     AP   G PSQG+  QR    P  +G +  PQ S SS      
Sbjct: 1234 PTCDACSPGHSGRHCERCAPGYYGNPSQGQPCQRDSQVPGPIGCNCDPQGSVSS------ 1287

Query: 391  LLV*APPAMCPATSRCQAQAQ 453
                     C A  +CQ +AQ
Sbjct: 1288 --------QCDAAGQCQCKAQ 1300

>pir||A38096 perlecan precursor - human gi|184427|gb|AAA52700.1| heparan sulfate
            proteoglycan
          Length = 4391

 Score = 37.7 bits (86), Expect = 0.090
 Identities = 27/81 (33%), Positives = 34/81 (41%), Gaps = 7/81 (8%)
 Frame = +1

Query: 232  PYCRCCA---AGRQPWSAAPSANGFPSQGESGQR----PSHVGASLRPQASTSSPGHSRG 390
            P C  C+   +GR     AP   G PSQG+  QR    P  +G +  PQ S SS      
Sbjct: 1232 PTCDACSPGHSGRHCERCAPGYYGNPSQGQPCQRDSQVPGPIGCNCDPQGSVSS------ 1285

Query: 391  LLV*APPAMCPATSRCQAQAQ 453
                     C A  +CQ +AQ
Sbjct: 1286 --------QCDAAGQCQCKAQ 1298

>sp|P98160|PGBM_HUMAN Basement membrane-specific heparan sulfate proteoglycan core protein
            precursor (HSPG) (Perlecan) (PLC)
          Length = 4391

 Score = 37.7 bits (86), Expect = 0.090
 Identities = 27/81 (33%), Positives = 34/81 (41%), Gaps = 7/81 (8%)
 Frame = +1

Query: 232  PYCRCCA---AGRQPWSAAPSANGFPSQGESGQR----PSHVGASLRPQASTSSPGHSRG 390
            P C  C+   +GR     AP   G PSQG+  QR    P  +G +  PQ S SS      
Sbjct: 1232 PTCDACSPGHSGRHCERCAPGYYGNPSQGQPCQRDSQVPGPIGCNCDPQGSVSS------ 1285

Query: 391  LLV*APPAMCPATSRCQAQAQ 453
                     C A  +CQ +AQ
Sbjct: 1286 --------QCDAAGQCQCKAQ 1298

>gb|AAA52699.1| heparan sulfate proteoglycan
          Length = 453

 Score = 37.7 bits (86), Expect = 0.090
 Identities = 27/81 (33%), Positives = 34/81 (41%), Gaps = 7/81 (8%)
 Frame = +1

Query: 232 PYCRCCA---AGRQPWSAAPSANGFPSQGESGQR----PSHVGASLRPQASTSSPGHSRG 390
           P C  C+   +GR     AP   G PSQG+  QR    P  +G +  PQ S SS      
Sbjct: 215 PTCDACSPGHSGRHCERCAPGYYGNPSQGQPCQRDSQVPGPIGCNCDPQGSVSS------ 268

Query: 391 LLV*APPAMCPATSRCQAQAQ 453
                    C A  +CQ +AQ
Sbjct: 269 --------QCDAAGQCQCKAQ 281

>emb|CAC18534.1| heparan sulfate proteoglycan perlecan [Homo sapiens]
          Length = 4370

 Score = 37.7 bits (86), Expect = 0.090
 Identities = 27/81 (33%), Positives = 34/81 (41%), Gaps = 7/81 (8%)
 Frame = +1

Query: 232  PYCRCCA---AGRQPWSAAPSANGFPSQGESGQR----PSHVGASLRPQASTSSPGHSRG 390
            P C  C+   +GR     AP   G PSQG+  QR    P  +G +  PQ S SS      
Sbjct: 1211 PTCDACSPGHSGRHCERCAPGYYGNPSQGQPCQRDSQVPGPIGCNCDPQGSVSS------ 1264

Query: 391  LLV*APPAMCPATSRCQAQAQ 453
                     C A  +CQ +AQ
Sbjct: 1265 --------QCDAAGQCQCKAQ 1277



EST assemble image


clone accession position
1 CL27b09_r AV394705 1 524
2 CL59b09_r AV397925 37 501




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research