KCC000294A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000294A_C01 KCC000294A_c01
atcagatcctgaggaagggaggggcatgtatgccgcatggcacggcgctgtgCAGGTAGG
CGGCGAATGCGTTGTGTGTCACTGGGATTGCCTGTACAGCCGCGAACTGTGTCGGCGGGA
TCACTGTGGCGTCAACGCATTGTGTGCGGTGTGAAGGCCATTGGAGCGGATGGCCAGTCG
GTGCAGAATGGCAGGCTGCACAGTTTTCAGACGACCCCGTATCAGAGCCTGATCGGACAT
GGCGGTTGCTGGGGCTCGAGAGAGAACAAAGCCTGCCCCCGTGGCACGGCACGAGAGAAG
AGTGAGAATCGCGAGAGTGAGTGAATCATGAGCTTGGTGCTTACGCGTTGCTCAGGGGCA
CCAGCTGGCGATGCTGGTGGGGAGAAGACAACACGATTACACGTTCGATGTGGTTGATGG
GTGATGTGGTTGACACGGATCGGTTCATGGATGTTGCTTTGTTCGCAGCATGTATTGGAT
GCCCGCCATCATTCGAGGCGCCCGATACAACACTTG


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000294A_C01 KCC000294A_c01
         (516 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

dbj|BAC31628.1| unnamed protein product [Mus musculus]                 35  0.43
dbj|BAC31589.1| unnamed protein product [Mus musculus]                 35  0.74
dbj|BAC65726.2| mKIAA1107 protein [Mus musculus]                       35  0.74
ref|ZP_00092490.1| COG0599: Uncharacterized homolog of gamma-car...    35  0.74
gb|AAL54912.2|AF170083_1 putative transcriptional repressor [Can...    34  1.3

>dbj|BAC31628.1| unnamed protein product [Mus musculus]
          Length = 340

 Score = 35.4 bits (80), Expect = 0.43
 Identities = 23/74 (31%), Positives = 37/74 (49%), Gaps = 2/74 (2%)
 Frame = -3

Query: 394 VLSSPHQHRQLVPLSNA*APSS*FTHSRDSH--SSLVPCHGGRLCSLSSPSNRHVRSGSD 221
           V+S+  + R +  ++N  A +  FTH +DSH  SS++    G+  S S+P     + GS 
Sbjct: 188 VMSTAVKSRAVARITNGTASNKSFTHEQDSHGNSSVIKRGDGKGLSASAPQTAAKKRGSS 247

Query: 220 TGSSENCAACHSAP 179
            G +       SAP
Sbjct: 248 NGCTAAQPRTKSAP 261

>dbj|BAC31589.1| unnamed protein product [Mus musculus]
          Length = 969

 Score = 34.7 bits (78), Expect = 0.74
 Identities = 23/84 (27%), Positives = 40/84 (47%), Gaps = 2/84 (2%)
 Frame = -3

Query: 424 SPINHIERVIVLSSPHQHRQLVPLSNA*APSS*FTHSRDSH--SSLVPCHGGRLCSLSSP 251
           SP   +   ++ ++  + R +  ++N  A +  FTH +DSH  SS++    G+  S S+P
Sbjct: 244 SPGQMVSNGVMSTAAVKSRAVARITNGTASNKSFTHEQDSHGNSSVIKRGDGKGLSASAP 303

Query: 250 SNRHVRSGSDTGSSENCAACHSAP 179
                + GS  G +       SAP
Sbjct: 304 QTAAKKRGSSNGCTAAQPRTKSAP 327

>dbj|BAC65726.2| mKIAA1107 protein [Mus musculus]
          Length = 1240

 Score = 34.7 bits (78), Expect = 0.74
 Identities = 23/84 (27%), Positives = 40/84 (47%), Gaps = 2/84 (2%)
 Frame = -3

Query: 424 SPINHIERVIVLSSPHQHRQLVPLSNA*APSS*FTHSRDSH--SSLVPCHGGRLCSLSSP 251
           SP   +   ++ ++  + R +  ++N  A +  FTH +DSH  SS++    G+  S S+P
Sbjct: 241 SPGQMVSNGVMSTAAVKSRAVARITNGTASNKSFTHEQDSHGNSSVIKRGDGKGLSASAP 300

Query: 250 SNRHVRSGSDTGSSENCAACHSAP 179
                + GS  G +       SAP
Sbjct: 301 QTAAKKRGSSNGCTAAQPRTKSAP 324

>ref|ZP_00092490.1| COG0599: Uncharacterized homolog of gamma-carboxymuconolactone
           decarboxylase subunit [Azotobacter vinelandii]
          Length = 354

 Score = 34.7 bits (78), Expect = 0.74
 Identities = 21/55 (38%), Positives = 25/55 (45%), Gaps = 3/55 (5%)
 Frame = +3

Query: 75  CVTGIACTAANCVGGITVASTHCVRCEGHWSG---WPVGAEWQAAQFSDDPVSEP 230
           C T  A +A  C GG  +A        G W G   WPV A W+  +F   PVS P
Sbjct: 30  CTTAAASSARQCWGGSPMAPP------GRWPGSWRWPVSAAWRLPRF--PPVSAP 76

>gb|AAL54912.2|AF170083_1 putative transcriptional repressor [Candida albicans]
          Length = 1085

 Score = 33.9 bits (76), Expect = 1.3
 Identities = 23/74 (31%), Positives = 35/74 (47%), Gaps = 10/74 (13%)
 Frame = -2

Query: 419 HQPHRTCNRVV---------FSPPASPAGAPEQRVSTKLMIHSLSRFSLFSRAVPRGQAL 267
           HQP  T N+            +PPA+P GAP+QR     ++H+ +   +    VP+ Q  
Sbjct: 648 HQPQHTQNQSPQLAQLPPHHSNPPANPHGAPQQRTGLPDLLHNSANIIIAPSQVPQPQQQ 707

Query: 266 FSLEPQQPP-CPIR 228
           +    QQP   P+R
Sbjct: 708 Y----QQPHIAPVR 717



EST assemble image


clone accession position
1 CL17d02_r AV394143 1 516
2 HCL094g06_r AV644859 53 516




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research