KCC000286A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000286A_C01 KCC000286A_c01
cattCTTCCACGCTCTTAAACTCATTCCAAGCGTCCCAAACCTTCGTTCAACTAGCCCAC
AGTCCCATTTAGTTTGCGATTCTCGCGGTCGGCCGCGCGCTCCCCGCGCTCAATGGCCTT
CGACGCCAGCGGCGCCCTCCAAAGCTGTTATGGAGCTAAGGAGGACGCGAACATGGACCC
GGCAGCTGGCCTGGTGCCTCTGACGAGCTCTCTGATACCGCCCCTGCTGGCTCACGCCTT
TGCGCTCCCGCAACTAGCCCAGGCACCCGCGCCCGCACAGTTGCAGCCTCAGGCCACAGC
CCAGGGCTATTATGGCTCCATGCTCAGCCCAGCGCCTTATGGGAGCGCTCGGCTATGCGA
CTGGCGCGTCTTACGCGCCGGTCCAGCAACAACAACCATCGCACCTCGCGAGCCTGCAGT
ATGGCTATCTGCACGCGCTTGCCACGGCAAGCCAGCAGCAACAGCAACAACAGCAGCAAC
AGCAGCATTCTGCTGCGGCTCTTCTGGCGCATGCACACAACGCAGCAGCCCTTGCGGCCG
TGC


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000286A_C01 KCC000286A_c01
         (543 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gb|AAB91452.1| CTG26 alternate open reading frame [Homo sapiens]       50  2e-05
gb|AAB05810.1| super cysteine rich protein; SCRP [Homo sapiens]        49  4e-05
pir||B53225 ecdysone-induced protein E74A - fruit fly (Drosophil...    45  6e-04
ref|NP_730714.2| Cysteine string protein CG6395-PC [Drosophila m...    45  6e-04
sp|Q03751|CSP_DROME Cysteine string protein gi|157129|gb|AAA2843...    45  6e-04

>gb|AAB91452.1| CTG26 alternate open reading frame [Homo sapiens]
          Length = 124

 Score = 50.1 bits (118), Expect = 2e-05
 Identities = 16/28 (57%), Positives = 16/28 (57%)
 Frame = -3

Query: 532 RAAALCACARRAAAECCCCCCCCCCCWL 449
           R    C C       CCCCCCCCCCCWL
Sbjct: 98  RGMGCCCCC------CCCCCCCCCCCWL 119

 Score = 44.7 bits (104), Expect = 8e-04
 Identities = 15/35 (42%), Positives = 15/35 (42%)
 Frame = -3

Query: 487 CCCCCCCCCCCWLAVASACR*PYCRLARCDGCCCW 383
           CCCCCCCCCCC                    CCCW
Sbjct: 103 CCCCCCCCCCC-------------------CCCCW 118

>gb|AAB05810.1| super cysteine rich protein; SCRP [Homo sapiens]
          Length = 46

 Score = 48.9 bits (115), Expect = 4e-05
 Identities = 19/45 (42%), Positives = 19/45 (42%)
 Frame = -3

Query: 520 LCACARRAAAECCCCCCCCCCCWLAVASACR*PYCRLARCDGCCC 386
           LC    R    CCCCCCCCCCC            C    C  CCC
Sbjct: 4   LCPDRSRCCCCCCCCCCCCCCC-----------CCCCCCCCFCCC 37

 Score = 47.8 bits (112), Expect = 1e-04
 Identities = 14/27 (51%), Positives = 16/27 (58%)
 Frame = -3

Query: 532 RAAALCACARRAAAECCCCCCCCCCCW 452
           R+   C C       CCCCCCCCCCC+
Sbjct: 8   RSRCCCCCCCCCCCCCCCCCCCCCCCF 34

 Score = 43.9 bits (102), Expect = 0.001
 Identities = 15/30 (50%), Positives = 16/30 (53%), Gaps = 1/30 (3%)
 Frame = -3

Query: 535 ARAAALCACARRAAAECCCCCCCCC-CCWL 449
           +R    C C       CCCCCCCCC CC L
Sbjct: 9   SRCCCCCCCCCCCCCCCCCCCCCCCFCCCL 38

>pir||B53225 ecdysone-induced protein E74A - fruit fly (Drosophila virilis)
          Length = 873

 Score = 45.1 bits (105), Expect = 6e-04
 Identities = 34/81 (41%), Positives = 36/81 (43%), Gaps = 13/81 (16%)
 Frame = +3

Query: 315 APCSAQRLMGALGYATGA------------SYAPVQQQQPSH-LASLQYGYLHALATASQ 455
           A  S+QR   A G+ T              SYAP QQQQ SH     Q   LH      Q
Sbjct: 599 AAASSQRSAAANGFGTHQHHSLQHQQQQQQSYAPQQQQQLSHHQQQQQQQQLHHQQQQQQ 658

Query: 456 QQQQQQQQQQHSAAALLAHAH 518
           QQQQQQ  Q   AAA LA  H
Sbjct: 659 QQQQQQHSQSQLAAAQLASTH 679

 Score = 33.5 bits (75), Expect = 1.9
 Identities = 18/34 (52%), Positives = 18/34 (52%)
 Frame = +3

Query: 384 QQQQPSHLASLQYGYLHALATASQQQQQQQQQQQ 485
           QQQQ  H    Q      L    QQQQQQQQQQQ
Sbjct: 332 QQQQHQHQQQQQQQQQQHLQQTQQQQQQQQQQQQ 365

 Score = 33.5 bits (75), Expect = 1.9
 Identities = 20/43 (46%), Positives = 21/43 (48%)
 Frame = +3

Query: 384 QQQQPSHLASLQYGYLHALATASQQQQQQQQQQQHSAAALLAH 512
           QQQQ  HL   Q           QQQQQQQQQQ   +A  L H
Sbjct: 343 QQQQQQHLQQTQ----QQQQQQQQQQQQQQQQQVFGSATTLLH 381

 Score = 32.7 bits (73), Expect = 3.2
 Identities = 17/39 (43%), Positives = 22/39 (55%)
 Frame = +3

Query: 402 HLASLQYGYLHALATASQQQQQQQQQQQHSAAALLAHAH 518
           H+ + Q   L  L  + QQQQQQQQQQQ  +     +AH
Sbjct: 381 HIKTEQNALLTPLQQSQQQQQQQQQQQQQHSLQANNNAH 419

 Score = 32.0 bits (71), Expect = 5.5
 Identities = 30/91 (32%), Positives = 37/91 (39%), Gaps = 20/91 (21%)
 Frame = +3

Query: 309 IMAPCSAQRLMGALGYAT-----------------GASYAPVQQQQPSHLASLQYGYLHA 437
           +  P +  RL+G L  AT                 GA+ + +QQQQ      LQ   L  
Sbjct: 9   LWCPDNDGRLVGGLDLATCITDDSTVDAENINPTIGANSSTLQQQQQLQQQQLQQQQLQQ 68

Query: 438 LATASQQ---QQQQQQQQQHSAAALLAHAHN 521
                QQ    QQQQQQQQ SA    + A N
Sbjct: 69  QQQQLQQLQQHQQQQQQQQQSADLCGSAARN 99

>ref|NP_730714.2| Cysteine string protein CG6395-PC [Drosophila melanogaster]
           gi|3047004|gb|AAD09430.1| cysteine string protein 2
           [Drosophila melanogaster] gi|28380625|gb|AAN12195.2|
           CG6395-PC [Drosophila melanogaster]
          Length = 228

 Score = 45.1 bits (105), Expect = 6e-04
 Identities = 16/28 (57%), Positives = 18/28 (64%)
 Frame = -3

Query: 538 AARAAALCACARRAAAECCCCCCCCCCC 455
           A +A  +C CA      CCCCCCCCCCC
Sbjct: 107 AVKAVVIC-CA--VITGCCCCCCCCCCC 131

 Score = 41.6 bits (96), Expect = 0.007
 Identities = 13/28 (46%), Positives = 15/28 (53%)
 Frame = -3

Query: 541 TAARAAALCACARRAAAECCCCCCCCCC 458
           T+    A+  C       CCCCCCCCCC
Sbjct: 104 TSPAVKAVVICCAVITGCCCCCCCCCCC 131

 Score = 35.4 bits (80), Expect = 0.49
 Identities = 11/21 (52%), Positives = 11/21 (52%)
 Frame = -3

Query: 517 CACARRAAAECCCCCCCCCCC 455
           CA        CCCCCCC  CC
Sbjct: 115 CAVITGCCCCCCCCCCCNFCC 135

 Score = 32.0 bits (71), Expect = 5.5
 Identities = 12/29 (41%), Positives = 13/29 (44%), Gaps = 3/29 (10%)
 Frame = -3

Query: 508 ARRAAAECCCC---CCCCCCCWLAVASAC 431
           A +A   CC     CCCCCCC       C
Sbjct: 107 AVKAVVICCAVITGCCCCCCCCCCCNFCC 135

>sp|Q03751|CSP_DROME Cysteine string protein gi|157129|gb|AAA28432.1| csp32
          Length = 249

 Score = 45.1 bits (105), Expect = 6e-04
 Identities = 16/28 (57%), Positives = 18/28 (64%)
 Frame = -3

Query: 538 AARAAALCACARRAAAECCCCCCCCCCC 455
           A +A  +C CA      CCCCCCCCCCC
Sbjct: 107 AVKAVVIC-CA--VITGCCCCCCCCCCC 131

 Score = 41.6 bits (96), Expect = 0.007
 Identities = 13/28 (46%), Positives = 15/28 (53%)
 Frame = -3

Query: 541 TAARAAALCACARRAAAECCCCCCCCCC 458
           T+    A+  C       CCCCCCCCCC
Sbjct: 104 TSPAVKAVVICCAVITGCCCCCCCCCCC 131

 Score = 35.4 bits (80), Expect = 0.49
 Identities = 11/21 (52%), Positives = 11/21 (52%)
 Frame = -3

Query: 517 CACARRAAAECCCCCCCCCCC 455
           CA        CCCCCCC  CC
Sbjct: 115 CAVITGCCCCCCCCCCCNFCC 135

 Score = 32.0 bits (71), Expect = 5.5
 Identities = 12/29 (41%), Positives = 13/29 (44%), Gaps = 3/29 (10%)
 Frame = -3

Query: 508 ARRAAAECCCC---CCCCCCCWLAVASAC 431
           A +A   CC     CCCCCCC       C
Sbjct: 107 AVKAVVICCAVITGCCCCCCCCCCCNFCC 135



EST assemble image


clone accession position
1 MXL054f05_r BP096209 1 353
2 MXL084c10_r BP097963 5 372
3 MXL007f08_r BP093381 11 531
4 CL16f01_r AV393993 13 521
5 MXL082g02_r BP097873 15 391
6 CL54c01_r AV396169 15 517
7 MXL097h02_r BP098715 15 385
8 MXL021e01_r BP094338 15 278
9 LCL028h12_r AV627580 18 424
10 MXL068g11_r BP097022 21 374
11 CL61g02_r AV396321 25 427
12 HCL078h07_r AV643944 47 546
13 MXL091g06_r BP098338 327 462




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research