KCC000271A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000271A_C01 KCC000271A_c01
tacaaacactGCAGACTGTTATCATAACTACTGGTACCTGCATTAGACGAGGCTTGGCCA
TCGCGACGGCAGTGGACCCGTGATGGCGATGTGCCCGCTCCGTAGCCGGCTGATCGCTTC
CCCCAAAGCTTTCCACGTGCGTTCGTCCCAGCCCAATGTGTGCCGCCTTGTGACCGTGGA
CTTCCGGCCCGATGGCGCGGTCGGCATTGCCGCATTCCGGAATGCGAGCGTCAACGACCA
CATTGCGCTTCTTGTCAAGGAGGCGGCGGAGGTTCGGGGGCTCGTCGACAAGCAGGACGC
GAGTATCGCTAAGCAGGACGCGAGAATCGCTAAGCAGGGCGCGAGAATCGCTAAGCAGGA
CGCGAAGATTGCCAAGCAGGACGCCAGAATCGCTAAGCAGGACTCGGTAATCCTGGTCAT
CGGAGAGGACAAGGTCATCAACGTTGCGACGCAGGTATGCATAGCTGTGCGGTACGTCGA
GCTCACGAGGCTCTACGACTCCGGCTTGTTGGAAAAGAAACCC


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000271A_C01 KCC000271A_c01
         (523 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

ref|XP_307915.1| ENSANGP00000021871 [Anopheles gambiae] gi|21291...    47  1e-04
ref|NP_501638.1| putative protein (96.7 kD) (4K91) [Caenorhabdit...    46  3e-04
gb|AAM48470.1| SD06668p [Drosophila melanogaster]                      45  6e-04
ref|NP_651276.1| CG6695-PA [Drosophila melanogaster] gi|23172195...    45  6e-04
ref|NP_870810.1| hypothetical protein [Pirellula sp.] gi|3244837...    43  0.003

>ref|XP_307915.1| ENSANGP00000021871 [Anopheles gambiae] gi|21291514|gb|EAA03659.1|
           ENSANGP00000021871 [Anopheles gambiae str. PEST]
          Length = 611

 Score = 47.4 bits (111), Expect = 1e-04
 Identities = 27/65 (41%), Positives = 40/65 (61%)
 Frame = +3

Query: 261 RRRRFGGSSTSRTRVSLSRTRESLSRARESLSRTRRLPSRTPESLSRTR*SWSSERTRSS 440
           R +R      SR+R   SR+R S SR++ S S+++R PSR+  S SR++ S S +R + S
Sbjct: 356 RSKRSRSRKRSRSRSKRSRSRRSPSRSKRSRSKSKRSPSRSKRSRSRSKRSRSRDRRKRS 415

Query: 441 TLRRR 455
             RRR
Sbjct: 416 RSRRR 420

>ref|NP_501638.1| putative protein (96.7 kD) (4K91) [Caenorhabditis elegans]
           gi|7503804|pir||T22422 hypothetical protein F49C12.15 -
           Caenorhabditis elegans gi|3877375|emb|CAA92521.1|
           Hypothetical protein F49C12.15 [Caenorhabditis elegans]
           gi|3879944|emb|CAA92493.1| Hypothetical protein
           F49C12.15 [Caenorhabditis elegans]
          Length = 869

 Score = 46.2 bits (108), Expect = 3e-04
 Identities = 35/93 (37%), Positives = 51/93 (54%), Gaps = 1/93 (1%)
 Frame = +3

Query: 183 SGPMARSALPHSGMRASTTTLRFLSRRRRRFGGSSTSRTRVSLSRTRE-SLSRARESLSR 359
           S  + R A+ +S +R++ +T    SR R R    ST   ++ L+RTR  S  + R S S 
Sbjct: 64  SADLRRQAIVNSAIRSAQSTASSRSRSRSRSRSRSTMNQQIRLARTRSASGGKLRRSRSA 123

Query: 360 TRRLPSRTPESLSRTR*SWSSERTRSSTLRRRY 458
            RR PS    S SR+R S S+ RTR+ ++  RY
Sbjct: 124 RRRSPS---SSASRSR-SRSTSRTRAQSIPIRY 152

>gb|AAM48470.1| SD06668p [Drosophila melanogaster]
          Length = 961

 Score = 45.1 bits (105), Expect = 6e-04
 Identities = 40/95 (42%), Positives = 50/95 (52%), Gaps = 4/95 (4%)
 Frame = +3

Query: 183 SGPMARSALPHSGMRASTTTLRFLSRRRRRFGGSSTSRTRV---SLSRTRESLSRARESL 353
           SG   RS    S  R S T     SRRRRR+   S SR+R    SLSR+R S SR+R   
Sbjct: 441 SGSRRRSRRSRSYHRRSRTR----SRRRRRYYSRSRSRSRSRSRSLSRSR-SRSRSRSRS 495

Query: 354 SRTRRLPSRTPE-SLSRTR*SWSSERTRSSTLRRR 455
              +R  +R+P    SR R S+SS  +  S+ RRR
Sbjct: 496 GSWKRYKARSPSYKRSRKRYSYSSRSSSGSSYRRR 530

 Score = 31.6 bits (70), Expect = 6.5
 Identities = 31/88 (35%), Positives = 41/88 (46%), Gaps = 3/88 (3%)
 Frame = +3

Query: 198 RSALPHSGMRASTTTLRFLSRRRRRFGG---SSTSRTRVSLSRTRESLSRARESLSRTRR 368
           R +  HS  R+ + T+       RR G    S  SR+    SRTR    R R   SR+R 
Sbjct: 416 RRSRSHSRSRSRSATVSRSRSGSRRSGSRRRSRRSRSYHRRSRTRS--RRRRRYYSRSRS 473

Query: 369 LPSRTPESLSRTR*SWSSERTRSSTLRR 452
                  SLSR+R S S  R+RS + +R
Sbjct: 474 RSRSRSRSLSRSR-SRSRSRSRSGSWKR 500

>ref|NP_651276.1| CG6695-PA [Drosophila melanogaster] gi|23172195|gb|AAF56321.2|
           CG6695-PA [Drosophila melanogaster]
          Length = 958

 Score = 45.1 bits (105), Expect = 6e-04
 Identities = 40/95 (42%), Positives = 50/95 (52%), Gaps = 4/95 (4%)
 Frame = +3

Query: 183 SGPMARSALPHSGMRASTTTLRFLSRRRRRFGGSSTSRTRV---SLSRTRESLSRARESL 353
           SG   RS    S  R S T     SRRRRR+   S SR+R    SLSR+R S SR+R   
Sbjct: 438 SGSRRRSRRSRSYHRRSRTR----SRRRRRYYSRSRSRSRSRSRSLSRSR-SRSRSRSRS 492

Query: 354 SRTRRLPSRTPE-SLSRTR*SWSSERTRSSTLRRR 455
              +R  +R+P    SR R S+SS  +  S+ RRR
Sbjct: 493 GSWKRYKARSPSYKRSRKRYSYSSRSSSGSSYRRR 527

 Score = 31.6 bits (70), Expect = 6.5
 Identities = 31/88 (35%), Positives = 41/88 (46%), Gaps = 3/88 (3%)
 Frame = +3

Query: 198 RSALPHSGMRASTTTLRFLSRRRRRFGG---SSTSRTRVSLSRTRESLSRARESLSRTRR 368
           R +  HS  R+ + T+       RR G    S  SR+    SRTR    R R   SR+R 
Sbjct: 413 RRSRSHSRSRSRSATVSRSRSGSRRSGSRRRSRRSRSYHRRSRTRS--RRRRRYYSRSRS 470

Query: 369 LPSRTPESLSRTR*SWSSERTRSSTLRR 452
                  SLSR+R S S  R+RS + +R
Sbjct: 471 RSRSRSRSLSRSR-SRSRSRSRSGSWKR 497

>ref|NP_870810.1| hypothetical protein [Pirellula sp.] gi|32448373|emb|CAD77887.1|
           hypothetical protein [Pirellula sp.]
          Length = 202

 Score = 42.7 bits (99), Expect = 0.003
 Identities = 19/52 (36%), Positives = 26/52 (49%)
 Frame = -2

Query: 402 SCLAILASCLAIFASCLAILAPCLAILASCLAILASCLSTSPRTSAASLTRS 247
           SC  + ASC  + ASC  + A C  + ASC  + ASC     R  A +  R+
Sbjct: 12  SCFVLRASCFVLRASCFVLRASCFVLRASCFVLRASCFVLRARARARARARA 63

 Score = 40.0 bits (92), Expect = 0.018
 Identities = 16/37 (43%), Positives = 21/37 (56%)
 Frame = -2

Query: 402 SCLAILASCLAIFASCLAILAPCLAILASCLAILASC 292
           SC  + ASC  + ASC  + A C  + ASC  + ASC
Sbjct: 5   SCFVLRASCFVLRASCFVLRASCFVLRASCFVLRASC 41

 Score = 35.4 bits (80), Expect = 0.45
 Identities = 16/50 (32%), Positives = 24/50 (48%)
 Frame = -2

Query: 447 ATLMTLSSPMTRITESCLAILASCLAIFASCLAILAPCLAILASCLAILA 298
           A+   L +    +  SC  + ASC  + ASC  + A C  + ASC  + A
Sbjct: 4   ASCFVLRASCFVLRASCFVLRASCFVLRASCFVLRASCFVLRASCFVLRA 53

 Score = 35.0 bits (79), Expect = 0.59
 Identities = 14/31 (45%), Positives = 18/31 (57%)
 Frame = -2

Query: 384 ASCLAIFASCLAILAPCLAILASCLAILASC 292
           ASC  + ASC  + A C  + ASC  + ASC
Sbjct: 4   ASCFVLRASCFVLRASCFVLRASCFVLRASC 34



EST assemble image


clone accession position
1 LC007a09_r AV619347 1 523
2 CL15c08_r AV393948 11 503
3 HCL015f08_r AV640403 28 269




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research