KCC000013A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KCC000013A_C01 KCC000013A_c01
CCTAATAAGAAAACAAATAATTCCAATTCATATATGAACATTTTTGCCTCCATTATTTCT
TGAAAATGTGGAATTGGCTGGAGCTGAACAGCACCCGCAAGGAC


Nr search


BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KCC000013A_C01 KCC000013A_c01
         (104 letters)

Database: nr 
           1,537,769 sequences; 498,525,298 total letters

Searching..................................................done

 ***** No hits found ******

  Database: nr
    Posted date:  Oct 14, 2003 12:26 AM
  Number of letters in database: 498,525,298
  Number of sequences in database:  1,537,769
  
Lambda     K      H
   0.318    0.135    0.401 

Gapped
Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Hits to DB: 103,628,909
Number of Sequences: 1537769
Number of extensions: 1044738
Number of successful extensions: 3117
Number of sequences better than 10.0: 0
Number of HSP's better than 10.0 without gapping: 3092
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 3117
length of database: 498,525,298
effective HSP length: 10
effective length of database: 483,147,608
effective search space used: 11595542592
frameshift window, decay const: 50,  0.1
T: 12
A: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)


EST assemble image


clone accession position
1 CL01c04_r AV393307 1 228
2 MX054b09_r BP088212 1 201




Chlamydomonas reinhardtii
Kazusa DNA Research Institute
Department of Plant Gene Research